ABSTRACT

Introduction:

We examined the effect of two β2-adrenoreceptor (β2AR) polymorphisms (A46G and C79G) in asthmatics presenting to the Emergency Department (ED) in relation to their response to standard therapy measured by change in Forced Expiratory Volume at one second (FEV1). Our hypothesis was that the polymorphisms in the β2AR gene would predict clinical response to therapy with 46G and 79C displaying decreased response to inhaled therapy.

Methods:

This was a pilot feasibility study of a convenience sample of patients seen in the ED for acute exacerbation of asthma. Baseline data collected included: age, gender, ethnicity, vital signs, baseline FEV1, body mass index (BMI), smoking history and medications taken prior to arrival to the ED. Patients received standard ED care and FEV1 was measured after each treatment. Blood was taken and genotyped.

Results:

Fifty-three patients were enrolled over a three-month period. Using mean improvement in FEV1 from baseline to the first treatment as the primary outcome of interest, we performed multivariable linear regression analyses, with the FEV1 change as the dependent variable. When modeled as an ordinal covariate representing the number of G alleles present, there was a significant positive trend for the C79G locus (p=0.035). Those who were GG homozygotes had a 0.284 L/min improvement in FEV1 (31%) after their initial albuterol treatment compared to 0.123 L/min (12%) in those who were CC homozygotes. This represents a 2.5 times relative difference and a 19% actual difference. Genotypes at the A46G locus were not associated with FEV1 change.

Conclusion:

In this pilot study of ED patients with acute asthma exacerbation, there was a significant effect of genotype on response to therapy.

This was an IRB-approved feasibility study of a convenience sample of patients seen in the ED for acute exacerbation of previously diagnosed asthma. Patients for this study were recruited in the ED of a large urban facility serving a local population of some 1.5 million individuals. Patients meeting inclusion criteria were consented and baseline data were obtained, including, age, ethnicity, height (cms) and weight (kg), BMI (kg/m2), smoking history (current, past, never), medication used prior to arrival, and past medical history. An initial set of vital signs including blood pressure (mmHg), respiratory rate and pulse rate as well as pulse oximetry (%) was collected. Prior to the initiation of therapy we also measured FEV1 using incentive spirometery (MicroSpirometer) with the best of three consecutive measurements.

Patients then received standardized care with albuterol-inhaled therapy, receiving 5.0 mg via a hand-held nebulizer every 20 minutes for a total of four treatments. Patients also received 60 mg of prednisone P.O. after the first inhaled treatment. Patients were not administered any other inhaled medications until after completion of the study protocol. Immediately after each inhaled treatment, the patient was reexamined and FEV1 measurements were obtained.

Study patients also underwent phlebotomy to obtain one 10ml green top tube (heparinized vacutainer) for genotype testing. For processing, we utilized an automated specimen component dispensing machine (the Cryo-Bio System). DNA extraction was accomplished on an ongoing basis using the Qiagen 96 DNA Blood Biorobotic Kit.

Genotyping assays were performed using the Taqman assay. Allele-specific probes for use in the TaqMan assay were designed for each of the polymorphic sites within the genes of interest. The oligonucleotide primers for amplification of the polymorphic region are: 5′: CCCAGCCAGTGCGCTTACCT and 3′: CCGTCTGCAGACGCTCGAAC (18). β2AR A(46)G probes used to detect each of the alleles are: GCACCCAATGGAAGCCATG and GCACCCAATACAAGCCATG (21). β2AR C(79)G probes used to detect each of the alleles are: GTCACGCAGCAAAGGGACG and GTCACGCAGGAAAGGGACTG (21).

RESULTS

Fifty-three patients were enrolled over a three-month period (Table 1). Twenty-one of these were male and the mean age was 39.7 years (range 19–57 years). Mean baseline FEV1 was 1.17 L/min (range 0.33 to 2.59 L/min) and improved to a mean of 1.42 L/min (range 0.29 – 3.15) after the first inhaled treatment. Our preliminary analyses revealed that particular polymorphisms were highly correlated such that the presence of a given allele at one locus could predict the allele at the other locus (i.e., the two were in linkage disequilibrium). Specifically, individuals homozygous for the ‘A’ allele at locus 46 were in all instances homozygous for the ‘G’ allele at locus 79.

Those individuals who were 79GG homozygotes had a 0.284 L/min improvement in FEV1 (31%) after their initial albuterol treatment compared to 0.123 L/min (12%) in those who were CC homozygotes. This represents a 2.5 times relative difference and a 19% actual difference (Figure 1). When modeled as an ordinal covariate representing the number of ‘G’ alleles present, there was a significant positive trend for FEV1 change with increasing numbers of ‘G’ alleles at the C79G locus (p=0.035). Genotypes at the A46G locus were not associated with FEV1 change in either regression model.

DISCUSSION

β-agonists are the most commonly prescribed asthma medications and the mainstay of therapy in the treatment of acute exacerbation in the ED.⁸ The candidate gene approach, which has proved so challenging for complex disease processes such as hypertension, diabetes and cancer, has been fairly successful in identifying variation involved in the treatment of asthma. SNPs have been identified that have pharmacologic implications with regards to response to β₂ agonists, muscarinic antagonists, 5-LOX inhibitors, CysLT1 antagonists, glucocortocoids, and theophylline.⁶ Two of the multiple β₂-agonists SNP’s (A46G and C79G) described in the literature are more common than the others and thus, we believe, more clinically relevant.^2,6,7

The first polymorphism, A46G, has been linked to higher levels of receptor down regulation after exposure to long-term β₂-agonist therapy.^3,4 Studies have shown that patients with a ‘G’ allele have increased nocturnal asthma symptoms, higher airway reactivity, and decreased response to β₂-agonist therapy.⁵ In the setting of an acute asthma exacerbation, these patients may need to resort to alternative forms of management such as corticosteroids or anticholinergics. It has also been suggested that individuals who die due to their asthma represent a group of 46G homozygotes, brittle asthmatics with desensitization of their β₂ receptor.⁹

The second polymorphism, C79G, appears to serve in protection against desensitization and/or down regulation of the receptor.^3,4 Patients with the 79G polymorphism exhibit decreased bronchial hyperactivity. Of note, when both the 46G and 79G polymorphisms were present, 46G activity was dominant over 79G in down regulating β₂-adrenoreceptors and more prevalent in moderate vs. mild asthmatics.¹⁰

In our study, as patients increased the number of copies of 79C in their β₂AR gene, their response to inhaled therapy of β₂-agonists decreased by almost 20%. Interestingly, we were not able to demonstrate an effect of the A46G locus on patients’ response to albuterol therapy as measured by FEV1. One explanation for this may be tachyphylaxis in these acutely stressed asthmatics. Given that the β₂AR in these patients is most likely “pre-desensitized” by endogenous epinephrine and norepinephrine, the lack of a measurable difference is not unexpected.

LIMITATIONS

The primary limitation of this pilot study is the small number of individuals who were 79C homozygotes. In addition the results may have been influenced by the large percentage of patients who received medications prior to contact with EMS or the ED. Their response to therapy may have been attenuated by these prior medications.

CONCLUSION

In this study of acute asthmatics we found a significantly higher rate of improvement for those patients who were 79GG homozygotes in the β₂AR gene when compared to 79CC homozygotes. While the need to have information about a patient’s genotype in an acute care setting such as the ED may not be self-evident, it is the promise of effective patient-specific therapies and the hope of obtaining prognostic information from a patient’s genotype that appeals most to the physicians involved in the acute care of patients. Such information may allow a goal-directed approach for individual patients and will allow the practitioner to predict the clinical course over the initial two- to four-hour time period of emergency care. In the setting of asthma, the long term potential of such information may be measured by fewer intubations, fewer hospitalizations and fewer deaths.¹